obimultiplex: demultiplex the sequence reads
#
Description #
The obimultiplex
command demultiplexes sequencing reads by identifying sample-specific tags (barcodes) and PCR primers in the sequences. It assigns each sequence to its corresponding sample based on the tag combinations and primer sequences provided in a sample description file.
The demultiplexing process involves:
- Identifying forward and reverse PCR primers in the sequences.
- Detecting sample-specific tags.
- Assigning sequences to samples based on the tag/primer combinations.
- Trimming primers and tags from the sequences.
- Reverse complementing the sequences if needed.
- Adding comprehensive annotations about the identification process.
The new obimultiplex sample description file format
#
If obimultiplex
is still able to use the old ngsfilter format used by the legacy obitools, it is now preferable to rely on the new format.
The new format is a CSV file, which can easily be prepared using an export from your favourite spreadsheet program.
# primer matching options
@param,primer_mismatches,2
@param,indels,false
# tag matching options
@param,matching,strict
experiment,sample,sample_tag,forward_primer,reverse_primer
wolf_diet,13a_F730603,aattaac,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG
wolf_diet,15a_F730814,gaagtag,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG
The
CSV
file is divided into two sections. The first section consists of lines beginning with @param in the first cell. These lines specify the parameters used to match the primers and tags to the sequence. The second section provides a description of all the samples (PCRs) included in the sequencing library. This section begins with a line containing the names of the columns used to describe the samples in the subsequent lines. Only the second section is required.
Basic format and required columns #
Below is an example for the minimal description of the PCRs multiplexed in the sequencing library. In the new version of OBITools4 this file is a CSV file.
The first line is mandatory and must contain at least the five column names presented below:
experiment: the name of the experiment that allows for grouping of samples;sample: the sample (PCR) name;sample_tag: the tag identifying the sample:Each sample tag must be unique within the library for each pair of primers. They can be provided in upper or lower case. No distinction is made between the two.
They can be a simple DNA word as here. This means that the same tag is used for both forward and reverse primers (eg:
aattaac).It can be two DNA words separated by a colon. For example,
aagtag:gaagtag. This means that the first tag is used for the forward primer and the second for the reverse primers.The example presented above :aattaacis equivalent toaattaac:aattaac.In the two-word syntax, if a forward or reverse primer is not tagged, the tag is replaced by a hyphen. For example,
aagtag:-or-:aagtag. Consequently, an experiments conducted without primer tags must declare a dummy tag:-:-.
For a given primer, all tags must be the same length. However, the tags of a primer pair (i.e. the forward and reverse primers) can be different lengths.forward_primer: the forward primer sequence
reverse_primer: the reverse primer sequence
The simplest obimultiplex command
#
📄 samples_simple.csvexperiment,sample,sample_tag,forward_primer,reverse_primer
wolf_diet,13a_F730603,aattaac,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG
wolf_diet,15a_F730814,gaagtag,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG
wolf_diet,26a_F040644,gaatatc,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG
wolf_diet,29a_F260619,gcctcct,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG
@HELIUM_000100422_612GNAAXX:7:6:9274:14951#0/1
ccaattaactagaacaggctcgtctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
+
CCCCCCCCCDCCCCCCCCCCCCCCCCCCCCCC=CBCCBCBCCCCCCDEFAEDEEEEBEAEJEJ?D?CD@^aVca\C????CEBC>I?D<>EEDDDEEEEEEEAFEEDECCCCCCCCCCCCCCCBCCCCCCBCCCCCCCCCDCCCCCCCCCCCBC
@HELIUM_000100422_612GNAAXX:7:57:18459:16145#0/1
ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
+
CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCacZXceafbd_e_bVb`cb[WZb]aaaaV`ECDDCEDCDKECFFEEEEEDEDEEJEEE@EEJECCCCCBCCCCCCCCCCCCCCCCCCCCDCCCCCCCCCCCCCCCBCC
@HELIUM_000100422_612GNAAXX:7:108:5640:3823#0/1
ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattgttcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
+
CCCCCCCBCCCCCCCCCCCCCCCCCCCCCCBCCCCCBCCCCCCC<CcCccbe[`F`accXV<TA\RYU\\ee_e[XZ[XEEEEEEEEEE?EEEEEEEEEEDEEEEEEECCCCCCCCCCCCCCCCCCCCCCCACCCCCACCCCCCCCCCCCCCCC
@HELIUM_000100422_612GNAAXX:7:108:6440:4223#0/1
ccgcctcctttagatcccactatgcttagccctaaacacaagtaattaatataacaaaattgttcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
+
CCCCCCCBCCCCCCCCCCCCCCCCCCCCBCCCCCBCCCCCCC<CcCccbe[`F`accXV<TA\RYU\\ee_e[XZ[XEEEEEEEEEE?EEEEEEEEEEDEEEEEEECCCCCCCCCCCCCCCCCCCCCCCACCCCCACCCCCCCCCCCCCCCC
obimultiplex -s samples_simple.csv \
wolf_4seq.fastq \
> wolf_4seq_simple.fastq
@HELIUM_000100422_612GNAAXX:7:6:9274:14951#0/1_sub[28..127] {"experiment":"wolf_diet","obimultiplex_amplicon_rank":"1/1","obimultiplex_direction":"reverse","obimultiplex_forward_error":0,"obimultiplex_forward_match":"ttagataccccactatgc","obimultiplex_forward_matching":"strict","obimultiplex_forward_primer":"ttagataccccactatgc","obimultiplex_forward_proposed_tag":"aattaac","obimultiplex_forward_tag":"aattaac","obimultiplex_forward_tag_dist":0,"obimultiplex_reverse_error":1,"obimultiplex_reverse_match":"tagaacaggctcgtctag","obimultiplex_reverse_matching":"strict","obimultiplex_reverse_primer":"tagaacaggctcctctag","obimultiplex_reverse_proposed_tag":"aattaac","obimultiplex_reverse_tag":"aattaac","obimultiplex_reverse_tag_dist":0,"sample":"13a_F730603"}
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
+
CCCBCCCCCCCCCCCCCCCEDEEFAEEEEEEEDDDEE><D?I>CBEC????C\acVa^@DC?D?JEJEAEBEEEEDEAFEDCCCCCCBCBCCBC=CCCCC
@HELIUM_000100422_612GNAAXX:7:57:18459:16145#0/1_sub[28..126] {"experiment":"wolf_diet","obimultiplex_amplicon_rank":"1/1","obimultiplex_direction":"forward","obimultiplex_forward_error":0,"obimultiplex_forward_match":"ttagataccccactatgc","obimultiplex_forward_matching":"strict","obimultiplex_forward_primer":"ttagataccccactatgc","obimultiplex_forward_proposed_tag":"gaatatc","obimultiplex_forward_tag":"gaatatc","obimultiplex_forward_tag_dist":0,"obimultiplex_reverse_error":0,"obimultiplex_reverse_match":"tagaacaggctcctctag","obimultiplex_reverse_matching":"strict","obimultiplex_reverse_primer":"tagaacaggctcctctag","obimultiplex_reverse_proposed_tag":"gaatatc","obimultiplex_reverse_tag":"gaatatc","obimultiplex_reverse_tag_dist":0,"sample":"26a_F040644"}
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
+
CCCCCCCCCCCCCCCCCCacZXceafbd_e_bVb`cb[WZb]aaaaV`ECDDCEDCDKECFFEEEEEDEDEEJEEE@EEJECCCCCBCCCCCCCCCCCC
@HELIUM_000100422_612GNAAXX:7:108:5640:3823#0/1_sub[28..127] {"experiment":"wolf_diet","obimultiplex_amplicon_rank":"1/1","obimultiplex_direction":"forward","obimultiplex_forward_error":0,"obimultiplex_forward_match":"ttagataccccactatgc","obimultiplex_forward_matching":"strict","obimultiplex_forward_primer":"ttagataccccactatgc","obimultiplex_forward_proposed_tag":"gcctcct","obimultiplex_forward_tag":"gcctcct","obimultiplex_forward_tag_dist":0,"obimultiplex_reverse_error":0,"obimultiplex_reverse_match":"tagaacaggctcctctag","obimultiplex_reverse_matching":"strict","obimultiplex_reverse_primer":"tagaacaggctcctctag","obimultiplex_reverse_proposed_tag":"gcctcct","obimultiplex_reverse_tag":"gcctcct","obimultiplex_reverse_tag_dist":0,"sample":"29a_F260619"}
ttagccctaaacacaagtaattaatataacaaaattgttcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
+
CCCBCCCCCBCCCCCCC<CcCccbe[`F`accXV<TA\RYU\\ee_e[XZ[XEEEEEEEEEE?EEEEEEEEEEDEEEEEEECCCCCCCCCCCCCCCCCCC
Annotations provided by the obimultiplex command
#
OBITools annotates its output to enable quality checks on ongoing tasks. obimultiplex
is adding the following annotations:
Sample description
Each read is attached to a sample (PCR) according to the sample description file. This involves adding two pieces of information to the read: the sample ID and the experiment ID (i.e. a group of samples).
experiment: “wolf_diet”The experiment name imputed to the barcode sequence
sample: “13a_F730603”The sample (PCR) name imputed to the barcode sequence
Amplicon description
The second task of
obimultiplexis to extract the amplified barcode sequence from the read. A read sequence can contain the sequence of a single amplicon or several, depending on the sequencing library preparation protocol. For each read,obimultiplexproduces one sequence per amplicon as output. This sequence is annotated by a set of tags that describe the properties of the barcode in question.obimultiplex_amplicon_rank: “1/1”obimultiplexis able to detect concatemer of several amplicons. This information is reported in theobimultiplex_amplicon_rankas a ratio here “1/1” meaning the first among one in the read. A value of “2/3” would mean the second amplicon detected among three in the read.obimultiplex_direction: “reverse”The direction in which the amplicon has been detected:
forward means, the forward primer has been identified, then the reverse complementary sequence of the reverse primer.
reverse means, the reverse primer has been identified, then the forward complementary sequence of the forward primer. The sequence of the barcode has been reverse complemented to be always reported as a sequence oriented from the forward to the reverse primer.
Primer matching
The primer matching algorithm can identify primer sequences in the reads despite sequencing errors. The threshold for matching primers can be configured either through command line options or by setting parameters in the sample description file.
Forward primer:
obimultiplex_forward_primer: “ttagataccccactatgc”The true forward primer sequence as provided in the
obimultiplexsample description file.obimultiplex_forward_match: “ttagataccccactatgc”The primer sequence as detected in the sequence read.
obimultiplex_forward_error: 0The number of differences between the
obimultiplex_forward_primerand theobimultiplex_forward_matchis equal to the value ofobimultiplex_forward_error.obimultiplexby default allows up to two mismatches. That threshold can be changed using the –allowed-mismatches option (or -e for the short version option).
Reverse primer:
obimultiplex_reverse_primer:“tagaacaggctcctctag”The true reverse primer sequence as provided in the
obimultiplexsample description file.obimultiplex_reverse_match:“tagaacaggctcgtctag”The primer sequence as detected in the sequence read.
obimultiplex_reverse_error:1Here one mismatch has been detected between the primer sequence and the read sequence match.
Tag identification
As for the primers,
obimultiplexcan account for sequencing errors in the portion of the reads that corresponds to the tag used to discriminate between samples. This allows some amplicons to be rescued, enabling the identification of the correct sample despite sequencing errors. This is particularly important when relatively high-error-rate sequencers are used, such as Nanopore sequencing.The same type of information is stored for both the forward and reverse tags. This includes information on the algorithm used to match the tag, the sequence identified on the read, the actual tag sequence proposed for association with the observation, and the number of differences between the observation and the proposal.
The tag matching algorithm and its parameters can be configured in the
obimultiplexsample description file.Forward tag:
“obimultiplex_forward_tag”:“gcctcct”
The observed sequence tag associated with the forward primer.
“obimultiplex_forward_proposed_tag”:“gcctcct”
The actual tag inferred by the matching algorithm.
obimultiplex_forward_matching: “strict”The algorithm used to match the tag on the sequence read. Possible values are:
strict: no sequencing error allowed in the sequence tag,hamming: only substitutions are allowed,indel: insertions/deletions are accepted in the sequence tag.
obimultiplex_forward_tag_dist: 0The number of differences between the observed and proposed sequence tag. When the algorithm is
strict, this attribute is always 0.
Reverse tag:
obimultiplex_reverse_tag: “gcctcct”The observed sequence tag associated with the reverse primer.
obimultiplex_reverse_proposed_tag: “gcctcct”The actual tag inferred by the matching algorithm.
obimultiplex_reverse_matching: “strict”The algorithm used to match the tag on the sequence read.
obimultiplex_reverse_tag_dist: 0The number of differences between the observed and proposed sequence tag.
Adding supplementary columns to the sample description #
In addition to the five required columns, as many columns as needed can be added to each sample description line. In the next example, four columns have been added to the sample description file:
- sex,
- age,
- plate,
- position
This information will be added to each amplicon assigned to a sample.
📄 samples_extra.csvexperiment,sample,sample_tag,forward_primer,reverse_primer,sex,age,plate,position
wolf_diet,13a_F730603,aattaac,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG,male,adult,02,A03
wolf_diet,15a_F730814,gaagtag,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG,male,juvenile,02,A01
wolf_diet,26a_F040644,gaatatc,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG,female,adult,01,B08
wolf_diet,29a_F260619,gcctcct,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG,female,adult,01,B12
obimultiplex -s samples_extra.csv \
wolf_4seq.fastq \
> wolf_4seq_extra.fastq
@HELIUM_000100422_612GNAAXX:7:6:9274:14951#0/1_sub[28..127] {"age":"adult","experiment":"wolf_diet","obimultiplex_amplicon_rank":"1/1","obimultiplex_direction":"reverse","obimultiplex_forward_error":0,"obimultiplex_forward_match":"ttagataccccactatgc","obimultiplex_forward_matching":"strict","obimultiplex_forward_primer":"ttagataccccactatgc","obimultiplex_forward_proposed_tag":"aattaac","obimultiplex_forward_tag":"aattaac","obimultiplex_forward_tag_dist":0,"obimultiplex_reverse_error":1,"obimultiplex_reverse_match":"tagaacaggctcgtctag","obimultiplex_reverse_matching":"strict","obimultiplex_reverse_primer":"tagaacaggctcctctag","obimultiplex_reverse_proposed_tag":"aattaac","obimultiplex_reverse_tag":"aattaac","obimultiplex_reverse_tag_dist":0,"plate":"02","position":"A03","sample":"13a_F730603","sex":"male"}
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
+
CCCBCCCCCCCCCCCCCCCEDEEFAEEEEEEEDDDEE><D?I>CBEC????C\acVa^@DC?D?JEJEAEBEEEEDEAFEDCCCCCCBCBCCBC=CCCCC
@HELIUM_000100422_612GNAAXX:7:57:18459:16145#0/1_sub[28..126] {"age":"adult","experiment":"wolf_diet","obimultiplex_amplicon_rank":"1/1","obimultiplex_direction":"forward","obimultiplex_forward_error":0,"obimultiplex_forward_match":"ttagataccccactatgc","obimultiplex_forward_matching":"strict","obimultiplex_forward_primer":"ttagataccccactatgc","obimultiplex_forward_proposed_tag":"gaatatc","obimultiplex_forward_tag":"gaatatc","obimultiplex_forward_tag_dist":0,"obimultiplex_reverse_error":0,"obimultiplex_reverse_match":"tagaacaggctcctctag","obimultiplex_reverse_matching":"strict","obimultiplex_reverse_primer":"tagaacaggctcctctag","obimultiplex_reverse_proposed_tag":"gaatatc","obimultiplex_reverse_tag":"gaatatc","obimultiplex_reverse_tag_dist":0,"plate":"01","position":"B08","sample":"26a_F040644","sex":"female"}
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
+
CCCCCCCCCCCCCCCCCCacZXceafbd_e_bVb`cb[WZb]aaaaV`ECDDCEDCDKECFFEEEEEDEDEEJEEE@EEJECCCCCBCCCCCCCCCCCC
@HELIUM_000100422_612GNAAXX:7:108:5640:3823#0/1_sub[28..127] {"age":"adult","experiment":"wolf_diet","obimultiplex_amplicon_rank":"1/1","obimultiplex_direction":"forward","obimultiplex_forward_error":0,"obimultiplex_forward_match":"ttagataccccactatgc","obimultiplex_forward_matching":"strict","obimultiplex_forward_primer":"ttagataccccactatgc","obimultiplex_forward_proposed_tag":"gcctcct","obimultiplex_forward_tag":"gcctcct","obimultiplex_forward_tag_dist":0,"obimultiplex_reverse_error":0,"obimultiplex_reverse_match":"tagaacaggctcctctag","obimultiplex_reverse_matching":"strict","obimultiplex_reverse_primer":"tagaacaggctcctctag","obimultiplex_reverse_proposed_tag":"gcctcct","obimultiplex_reverse_tag":"gcctcct","obimultiplex_reverse_tag_dist":0,"plate":"01","position":"B12","sample":"29a_F260619","sex":"female"}
ttagccctaaacacaagtaattaatataacaaaattgttcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
+
CCCBCCCCCBCCCCCCC<CcCccbe[`F`accXV<TA\RYU\\ee_e[XZ[XEEEEEEEEEE?EEEEEEEEEEDEEEEEEECCCCCCCCCCCCCCCCCCC
Tuning the primer and tag matching #
Optimising primer matching and tag identification can increase the yield of recognised amplicons. However, this must be balanced against the risk of erroneous barcodes being extracted and/or assigned to the wrong sample if the parameters are set too loosely.
Changing primer matching parameters #
Two parameters are available to tune the matching of primers:
- The number of differences allowed between the primer and the read sequence,
- The nature of the differences:
- Only mismatches are allowed (default),
- mismatches and insertions/deletions (indels) are permitted.
These two parameters can be set using options on the obimultiplex
command line, or by setting parameters in the sample description file using @param lines at the beginning of the file.
Changing the nature of the differences #
By default only mismatches are allowed as differences between the primer sequence and the read sequence. This is perfectly suited for the Illumina or Aviti sequencers.
With Oxford Nanopore sequencers, it is better to allow indels in addition to mismatches, as indels represent half of the sequencing errors produced by these machines.
Allowing indels can be done by adding the --with-indels option to the obimultiplex
command.
obimultiplex -s samples_simple.csv \
--with-indels \
wolf_4seq.fastq \
> wolf_4seq_simple.fastq
It can also be set using the @param,indels line in the sample description file.
@param,indels,false
@param,indels,true
Here a modified version of the sample description file including the @param,indels,true line.
# Indels are allowed during the primer matching step
@param,indels,true
experiment,sample,sample_tag,forward_primer,reverse_primer
wolf_diet,13a_F730603,aattaac,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG
wolf_diet,15a_F730814,gaagtag,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG
wolf_diet,26a_F040644,gaatatc,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG
wolf_diet,29a_F260619,gcctcct,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG
If such file is used, no need to add the --with-indel option to the obimultiplex
command.
obimultiplex -s samples_with_indels.csv \
wolf_4seq.fastq \
> wolf_4seq_with_indels.fastq
@HELIUM_000100422_612GNAAXX:7:6:9274:14951#0/1_sub[28..127] {"experiment":"wolf_diet","obimultiplex_amplicon_rank":"1/1","obimultiplex_direction":"reverse","obimultiplex_forward_error":0,"obimultiplex_forward_match":"ttagataccccactatgc","obimultiplex_forward_matching":"strict","obimultiplex_forward_primer":"ttagataccccactatgc","obimultiplex_forward_proposed_tag":"aattaac","obimultiplex_forward_tag":"aattaac","obimultiplex_forward_tag_dist":0,"obimultiplex_reverse_error":1,"obimultiplex_reverse_match":"tagaacaggctcgtctag","obimultiplex_reverse_matching":"strict","obimultiplex_reverse_primer":"tagaacaggctcctctag","obimultiplex_reverse_proposed_tag":"aattaac","obimultiplex_reverse_tag":"aattaac","obimultiplex_reverse_tag_dist":0,"sample":"13a_F730603"}
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
+
CCCBCCCCCCCCCCCCCCCEDEEFAEEEEEEEDDDEE><D?I>CBEC????C\acVa^@DC?D?JEJEAEBEEEEDEAFEDCCCCCCBCBCCBC=CCCCC
@HELIUM_000100422_612GNAAXX:7:57:18459:16145#0/1_sub[28..126] {"experiment":"wolf_diet","obimultiplex_amplicon_rank":"1/1","obimultiplex_direction":"forward","obimultiplex_forward_error":0,"obimultiplex_forward_match":"ttagataccccactatgc","obimultiplex_forward_matching":"strict","obimultiplex_forward_primer":"ttagataccccactatgc","obimultiplex_forward_proposed_tag":"gaatatc","obimultiplex_forward_tag":"gaatatc","obimultiplex_forward_tag_dist":0,"obimultiplex_reverse_error":0,"obimultiplex_reverse_match":"tagaacaggctcctctag","obimultiplex_reverse_matching":"strict","obimultiplex_reverse_primer":"tagaacaggctcctctag","obimultiplex_reverse_proposed_tag":"gaatatc","obimultiplex_reverse_tag":"gaatatc","obimultiplex_reverse_tag_dist":0,"sample":"26a_F040644"}
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
+
CCCCCCCCCCCCCCCCCCacZXceafbd_e_bVb`cb[WZb]aaaaV`ECDDCEDCDKECFFEEEEEDEDEEJEEE@EEJECCCCCBCCCCCCCCCCCC
@HELIUM_000100422_612GNAAXX:7:108:5640:3823#0/1_sub[28..127] {"experiment":"wolf_diet","obimultiplex_amplicon_rank":"1/1","obimultiplex_direction":"forward","obimultiplex_forward_error":0,"obimultiplex_forward_match":"ttagataccccactatgc","obimultiplex_forward_matching":"strict","obimultiplex_forward_primer":"ttagataccccactatgc","obimultiplex_forward_proposed_tag":"gcctcct","obimultiplex_forward_tag":"gcctcct","obimultiplex_forward_tag_dist":0,"obimultiplex_reverse_error":0,"obimultiplex_reverse_match":"tagaacaggctcctctag","obimultiplex_reverse_matching":"strict","obimultiplex_reverse_primer":"tagaacaggctcctctag","obimultiplex_reverse_proposed_tag":"gcctcct","obimultiplex_reverse_tag":"gcctcct","obimultiplex_reverse_tag_dist":0,"sample":"29a_F260619"}
ttagccctaaacacaagtaattaatataacaaaattgttcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
+
CCCBCCCCCBCCCCCCC<CcCccbe[`F`accXV<TA\RYU\\ee_e[XZ[XEEEEEEEEEE?EEEEEEEEEEDEEEEEEECCCCCCCCCCCCCCCCCCC
@HELIUM_000100422_612GNAAXX:7:108:6440:4223#0/1_sub[26..125] {"experiment":"wolf_diet","obimultiplex_amplicon_rank":"1/1","obimultiplex_direction":"forward","obimultiplex_forward_error":2,"obimultiplex_forward_match":"ttagatcccactatgc","obimultiplex_forward_matching":"strict","obimultiplex_forward_primer":"ttagataccccactatgc","obimultiplex_forward_proposed_tag":"gcctcct","obimultiplex_forward_tag":"gcctcct","obimultiplex_forward_tag_dist":0,"obimultiplex_reverse_error":0,"obimultiplex_reverse_match":"tagaacaggctcctctag","obimultiplex_reverse_matching":"strict","obimultiplex_reverse_primer":"tagaacaggctcctctag","obimultiplex_reverse_proposed_tag":"gcctcct","obimultiplex_reverse_tag":"gcctcct","obimultiplex_reverse_tag_dist":0,"sample":"29a_F260619"}
ttagccctaaacacaagtaattaatataacaaaattgttcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
+
CCCBCCCCCBCCCCCCC<CcCccbe[`F`accXV<TA\RYU\\ee_e[XZ[XEEEEEEEEEE?EEEEEEEEEEDEEEEEEECCCCCCCCCCCCCCCCCCC
It can be noted that on our four sequences example, the @param,indels,true allows for retrieving an amplicon also from the fourth sequence.
A different mode can be allowed for the forward and reverse primers by setting the @param,forward_indels and @param,reverse_indels parameters.
@param,forward_indels,true
@param,reverse_indels,false
It is even possible to be more precise by defining the indel mode for each primer by setting the @param,indels parameter with the sequence of the primer targeted:
@param,primer_indels,TTAGATACCCCACTATGC,true
@param,primer_indels,TAGAACAGGCTCCTCTAG,false
Setting the maximum number of mismatches allowed #
The maximum number of mismatches allowed is set using the --allowed-mismatches option in its long format or -e in its short format. The default value for this option is two. This number of mismatches is per primer. It can also be set adding the @param,primer_mismatches parameter in the sample description file.
@param,primer_mismatches,4
This sets the maximum number of differences allowed for each primer to four. If indels are permitted, each insertion/deletion accounts as one difference, as a mismatch.
A different number of differences can be allowed for the forward and reverse primers by setting the @param,forward_mismatches and @param,reverse_mismatches parameters.
@param,forward_mismatches,4
@param,reverse_mismatches,2
It is even possible to be more precise by defining a different number of mismatches for each primer by setting the @param,primer_mismatches parameter with the sequence of the primer targeted:
@param,primer_mismatches,TTAGATACCCCACTATGC,4
@param,primer_mismatches,TAGAACAGGCTCCTCTAG,2
Changing tag matching parameters #
There are more parameters for tag matching than for primer matching. They can only be changed by parametrizing them in the ‘@param’ section of the sample description file. These parameters have no corresponding option available on the obimultiplex
command.
The tag matching algorithms #
There are three matching algorithms:
strict: the primers are matched exactly, no differences are allowed. This is the default.hamming: only mismatching bases are allowed.indel: insertions/deletions are accepted in addition to mismatches.
Each matcher returns a distance between the tag present in the sample description file and the observed tag on the sequence read. The closest tag is assumed to be the correct one. If two true tags are at the same closest distance to the observed one, the tag is considered as not identified and the corresponding amplicon will not be assigned to a sample.
@param,matching,hamming
The parameter usable to specify the matching algorithm for the forward and reverse primers disctinctively is @param,forward_matching, and @param,reverse_matching.
@param,forward_matching,hamming
@param,reverse_matching,indel
It is also possible to specify a tag matching algorithm for a specific primer by writing a @param,matching parameter with the targeted primer sequence.
@param,matching,TTAGATACCCCACTATGC,hamming
@param,matching,TAGAACAGGCTCCTCTAG,strict
Specifying the spacer length between the primers and the sequence tag #
Most of the time, the tag sequences stick straight onto the 5’ end of the primer sequence.
age
5'-TAG-PRIMER->3'
This property is used to extract the tag sequence once the primer has been located on the read. It is possible to indicate that some bases have been added in between the tag and the primer sequence.
5'-TAG-SPACER-PRIMER->3'
It is important to indicate the length of this spacer to the obimultiplex
command to allow it to correctly extract the tag sequence. As for the previously described parameters, this spacer length can be specified globally for the forward and reverse primers, or for any primer individually.
To specify globally you can use the @param,spacer parametter
@param,spacer,2
The forward, reverse version of the parameter is
@param,forward_spacer,2
@param,reverse_spacer,3
To specify the spacer length individually for a given primer, you can use:
@param,spacer,TTAGATACCCCACTATGC,2
@param,spacer,TAGAACAGGCTCCTCTAG,4
Tag specially designed to allow matching with indels #
Matching tag when allowing indels is not trivial as we cannot know at first which exact length will have the observed version of the tag on the sequence read. Because tags are very short sequences (a few nucleotides) it is almost impossible to distinguish between a mismatch and an insertion/deletion in terms of sequence alignment.
To delimitate the tag and allows a robust alignment that accounts for insertion/deletion a strategy is to design tag using only three of the four nucleotides (e.g. A,C,T but not G) and to flank the tag on each side by at least two of the missing nucleotide (e.g. GGACTTCAGG for the tag ACTTCA not containing any G).
To indicate such tagging strategy, the sample description file has to be parametrised as following:
# Indicates the tag matching strategy
@param,matching,indel
# Indicates to use the nucleotide G as tag delimiter
@param,tag_delimiter,G
# The tag used (not containing any G) is indicated without the flanking G
experiment,sample,sample_tag,forward_primer,reverse_primer
wolf_diet,13a_F730603,aattaac,TTAGATACCCCACTATGC,TAGAACAGGCTCCTCTAG
As for the above parameters, versions of the parameter exist for specifying differently the forward and reverse properties.
@param,forward_tag_delimiter,G
@param,reverse_tag_delimiter,T
And it is also possible to specify the tag delimiter for a given primer.
@param,tag_delimiter,TTAGATACCCCACTATGC,G
Understanding why some amplicons are not assigned to a sample #
The obimultiplex
can reject some reads because it is unable to identify any amplicon. It can also reject some detected amplicon because it is not able to assign it to a sample. In these cases, the corresponding sequences are not included in the result file. The problematic sequences can be stored separately in another file whose name is specified by the --unidentified or -u option.
obimultiplex -s samples_simple.csv \
-u wolf_4seq_bad.fastq \
wolf_4seq.fastq \
> wolf_4seq_simple.fastq
The resulting file containing the demultiplexed amplicons
📄 wolf_4seq_simple.fastq@HELIUM_000100422_612GNAAXX:7:6:9274:14951#0/1_sub[28..127] {"experiment":"wolf_diet","obimultiplex_amplicon_rank":"1/1","obimultiplex_direction":"reverse","obimultiplex_forward_error":0,"obimultiplex_forward_match":"ttagataccccactatgc","obimultiplex_forward_matching":"strict","obimultiplex_forward_primer":"ttagataccccactatgc","obimultiplex_forward_proposed_tag":"aattaac","obimultiplex_forward_tag":"aattaac","obimultiplex_forward_tag_dist":0,"obimultiplex_reverse_error":1,"obimultiplex_reverse_match":"tagaacaggctcgtctag","obimultiplex_reverse_matching":"strict","obimultiplex_reverse_primer":"tagaacaggctcctctag","obimultiplex_reverse_proposed_tag":"aattaac","obimultiplex_reverse_tag":"aattaac","obimultiplex_reverse_tag_dist":0,"sample":"13a_F730603"}
ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
+
CCCBCCCCCCCCCCCCCCCEDEEFAEEEEEEEDDDEE><D?I>CBEC????C\acVa^@DC?D?JEJEAEBEEEEDEAFEDCCCCCCBCBCCBC=CCCCC
@HELIUM_000100422_612GNAAXX:7:57:18459:16145#0/1_sub[28..126] {"experiment":"wolf_diet","obimultiplex_amplicon_rank":"1/1","obimultiplex_direction":"forward","obimultiplex_forward_error":0,"obimultiplex_forward_match":"ttagataccccactatgc","obimultiplex_forward_matching":"strict","obimultiplex_forward_primer":"ttagataccccactatgc","obimultiplex_forward_proposed_tag":"gaatatc","obimultiplex_forward_tag":"gaatatc","obimultiplex_forward_tag_dist":0,"obimultiplex_reverse_error":0,"obimultiplex_reverse_match":"tagaacaggctcctctag","obimultiplex_reverse_matching":"strict","obimultiplex_reverse_primer":"tagaacaggctcctctag","obimultiplex_reverse_proposed_tag":"gaatatc","obimultiplex_reverse_tag":"gaatatc","obimultiplex_reverse_tag_dist":0,"sample":"26a_F040644"}
ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
+
CCCCCCCCCCCCCCCCCCacZXceafbd_e_bVb`cb[WZb]aaaaV`ECDDCEDCDKECFFEEEEEDEDEEJEEE@EEJECCCCCBCCCCCCCCCCCC
@HELIUM_000100422_612GNAAXX:7:108:5640:3823#0/1_sub[28..127] {"experiment":"wolf_diet","obimultiplex_amplicon_rank":"1/1","obimultiplex_direction":"forward","obimultiplex_forward_error":0,"obimultiplex_forward_match":"ttagataccccactatgc","obimultiplex_forward_matching":"strict","obimultiplex_forward_primer":"ttagataccccactatgc","obimultiplex_forward_proposed_tag":"gcctcct","obimultiplex_forward_tag":"gcctcct","obimultiplex_forward_tag_dist":0,"obimultiplex_reverse_error":0,"obimultiplex_reverse_match":"tagaacaggctcctctag","obimultiplex_reverse_matching":"strict","obimultiplex_reverse_primer":"tagaacaggctcctctag","obimultiplex_reverse_proposed_tag":"gcctcct","obimultiplex_reverse_tag":"gcctcct","obimultiplex_reverse_tag_dist":0,"sample":"29a_F260619"}
ttagccctaaacacaagtaattaatataacaaaattgttcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
+
CCCBCCCCCBCCCCCCC<CcCccbe[`F`accXV<TA\RYU\\ee_e[XZ[XEEEEEEEEEE?EEEEEEEEEEDEEEEEEECCCCCCCCCCCCCCCCCCC
The file containing the rejected sequences
📄 wolf_4seq_bad.fastq@HELIUM_000100422_612GNAAXX:7:108:6440:4223#0/1 {"obimultiplex_error":"No barcode identified"}
ccgcctcctttagatcccactatgcttagccctaaacacaagtaattaatataacaaaattgttcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
+
CCCCCCCBCCCCCCCCCCCCCCCCCCCCBCCCCCBCCCCCCC<CcCccbe[`F`accXV<TA\RYU\\ee_e[XZ[XEEEEEEEEEE?EEEEEEEEEEDEEEEEEECCCCCCCCCCCCCCCCCCCCCCCACCCCCACCCCCCCCCCCCCCCC
In the latest file, the rejected sequences are annotated with a obimultiplex_error tag indicating the reason why the amplicon was discarded.
It is for example possible to make some statistics about the rejection causes:
obicsv -k obimultiplex_error \
wolf_4seq_bad.fastq \
| csvsql --query 'select obimultiplex_error,
count(*) as n
from errors
group by obimultiplex_error' \
--tables errors \
-d ',' \
| csvlook --no-inference
| obimultiplex_error | n |
| --------------------- | - |
| No barcode identified | 1 |
In this trivial example with a single rejected sequence you obtain only a single reason No barcode identified occurring only a single time.
Synopsis #
obimultiplex [--allowed-mismatches|-e <int>] [--batch-mem <string>]
[--batch-size <int>] [--batch-size-max <int>]
[--compress|-Z] [--debug] [--ecopcr] [--embl] [--fasta]
[--fasta-output] [--fastq] [--fastq-output] [--force-one-cpu]
[--genbank] [--help|-h|-?] [--input-OBI-header]
[--input-json-header] [--json-output] [--keep-errors]
[--max-cpu <int>] [--no-order] [--no-progressbar]
[--out|-o <FILENAME>] [--output-OBI-header|-O]
[--output-json-header] [--paired-with <FILENAME>] [--pprof]
[--pprof-goroutine <int>] [--pprof-mutex <int>] [--skip-empty]
[--solexa] [--tag-list|-s <string>] [--taxonomy|-t <string>]
[--template] [--unidentified|-u <string>] [--version]
[--with-indels] [<args>]
Options #
obimultiplex
specific options
#
--allowed-mismatches|-e<INTEGER>: Used to specify the number of errors allowed for matching primers. (default: -1)--keep-errors: Prints symbol counts. (default: false)--paired-with<FILENAME>: filename containing the paired reads.--tag-list|-s<string>: File name of the NGSFilter file describing PCRs.--template: Print on the standard output an example of CSV configuration file. (default: false)--unidentified|-u<string>: Filename used to store the sequences unassigned to any sample.--with-indels: Allows for indels during the primers matching. (default: false)
Taxonomic options #
--taxonomy|-t<string>: Path to the taxonomic database.
Controlling the input data #
OBITools4 generally recognizes the input file format. It also recognizes whether the input file is compressed using GZIP. But some rare files can be misidentified, so the following options allow the user to force the format, thus bypassing the format identification step.The file format options #
--fasta: indicates that sequence data is in fasta format.--fastq: indicates that sequence data is in fastq format.--embl: indicates that sequence data is in EMBL-ENA flatfile format.--csv: indicates that sequence data is in CSV format.--genbank: indicates that sequence data is in GenBank flatfile format.--ecopcr: indicates that sequence data is in the old ecoPCR tabulated format.
Controlling the way OBITools4 are formatting annotations #
These options only apply to the FASTA and FASTQ formats--input-OBI-header: FASTA/FASTQ title line annotations follow the old OBI format.--input-json-header: FASTA/FASTQ title line annotations follow the JSON format.
Controlling quality score decoding #
This option only applies to the FASTQ formats--solexa: decodes quality string according to the old Solexa specification. (default: the standard Sanger encoding is used, env: OBISSOLEXA)
Controlling the output data #
--compress|-Z: output is compressed using gzip. (default: false)--no-order: the OBITools ensure that the order between the input file and the output file does not change. When multiple files are processed, they are processed one at a time. If the –no-order option is added to a command, multiple input files can be opened at the same time and their contents processed in parallel. This usually increases processing speed, but does not guarantee the order of the sequences in the output file. Also, processing multiple files in parallel may require more memory to perform the computation.--fasta-output: writes sequence data in fasta format (default if quality data is not available).--fastq-output: writes sequence data in fastq format (default if quality data is available).--json-output: writes sequence data in JSON format.--out|-o<FILENAME>: filename used for saving the output (default: “-”, the standard output)--output-OBI-header|-O: writes output FASTA/FASTQ title line annotations in OBI format (default: JSON).--output-json-header: writew output FASTA/FASTQ title line annotations in JSON format (the default format).--skip-empty: sequences of length equal to zero are removed from the output (default: false).--no-progressbar: deactivates progress bar display (default: false).
General options #
--help|-h|-?: shows this help.--version: prints the version and exits.--silent-warning: This option tells obitools to stop displaying warnings. This behaviour can be controlled by setting the OBIWARNINGS environment variable.
Computation related options #
--max-cpu<INTEGER>: OBITools can take advantage of your computer’s multi-core architecture by parallelizing the computation across all available CPUs. Computing on more CPUs usually requires more memory to perform the computation. Reducing the number of CPUs used to perform a calculation is also a way to indirectly control the amount of memory used by the process. The number of CPUs used by OBITools can also be controlled by setting the OBIMAXCPU environment variable.--force-one-cpu: forces the use of a single CPU core for parallel processing (default: false).--batch-size<INTEGER>: minimum number of sequences per batch for parallel processing (floor, default: 1, env: OBIBATCHSIZE)--batch-size-max<INTEGER>: maximum number of sequences per batch for parallel processing (ceiling, default: 2000, env: OBIBATCHSIZEMAX)--batch-mem<STRING>: maximum memory per batch (e.g. 128K, 64M, 1G; default: 128M; set to 0 to disable, env: OBIBATCHMEM)
Debug related options #
--debug: enables debug mode, by setting log level to debug (default: false, env: OBIDEBUG)--pprof: enables pprof server. Look at the log for details. (default: false).--pprof-mutex<INTEGER>: enables profiling of mutex lock. (default: 10, env: OBIPPROFMUTEX)--pprof-goroutine<INTEGER>: enables profiling of goroutine blocking profile. (default: 6060, env: OBIPPROFGOROUTINE)
Examples #
obimultiplex --help